Osteosarcoma pochodzi od komórek macierzystych dawcy niosących gen choroby Norrie

Po allogenicznym przeszczepieniu szpiku kostnego odnotowano niewiele przypadków osteosarcoma.1 Zgłaszamy rozwój kostniakomięsaka u biorcy 17 lat po transplantacji komórek macierzystych.
23-miesięczny chłopiec z .-talasemią otrzymał przeszczep szpiku kostnego od swojego 11-letniego brata identycznego z HLA we wrześniu 1989. Choroba Norriego została zdiagnozowana u dawcy po 12 miesiącu życia, po wyłuszczeniu prawej wykonano oko, ponieważ podejrzewano obustronnego siatkówczaka. W czasie operacji nie przeprowadzono analizy genetycznej. Choroba Norriego jest chorobą recesywną sprzężoną z chromosomem X wywołaną przez mutacje genu NDP na Xp11.4.2. Wpływa głównie na oko i prawie zawsze prowadzi do ślepoty. Schemat chemioterapii przed przeszczepem szpiku zawierał duże dawki cyklofosfamidu i busulfanu. Od 30 dnia pacjentka była kompletną hematopoetyczną chimerą. Siedemnaście lat później u 18-letniego biorcy wystąpił przerzutowy chondroblastyczny mięsak kości miednicy. Pomimo agresywnego leczenia pacjent zmarł z powodu progresji guza 22 miesiące po rozpoznaniu osteosarcoma i 19 lat po transplantacji komórek macierzystych.
Rycina 1. Rycina 1. Immunofenotyp i chimeryzm linii komórek kostniakomięsaka. Panel A pokazuje wyniki analizy cytometrii przepływowej i immunofenotypu linii komórkowej kostniakomięsaka. Łącznie 2 x 105 do 5 x 105 komórek barwiono przez 20 minut przeciwciałami monoklonalnymi przeciwko CD45, CD14, CD34, CD49, CD24, CD44, CD29, CD105, CD90 i CD73 (Beckman Coulter) i 0,5 mg jodku propidyny na mililitr (Sigma) w analizie żywotności. Zastosowano odpowiednie kombinacje skoniugowanych z fluoresceiną izotiocyjanianów, sprzężonych z fikoerytryną i przeciwciał monoklonalnych sprzężonych z białkiem chlorofilowym perydyn. Oznaczone komórki analizowano na cytometrze Epics XL (Beckman Coulter) przy użyciu oprogramowania XL2. Szary oznacza kontrole negatywne, a zielony oznacza komórki dodatnie. Poziome linie wskazują procenty dodatnich komórek w próbkach. Panel B pokazuje chimeryzm. Genomowy DNA ekstrahowano z krwi obwodowej pacjenta, próbki biopsyjnej miednicy i linii komórek kostniakomięsaka oraz z krwi obwodowej dawcy za pomocą standardowych procedur (metoda fenol-chloroform). Do oceny chimeryzmu użyto półilościowego podejścia opartego na amplifikacji polimorficznych łańcuchów polimerazy (sekwencje zmian DNA o częstotliwości ponad 1% u ludzi, takie jak zmienna liczba powtórzeń tandemowych). Startery były 5 GCCCCATAGGTTTTGAACTCA3 (przedni starter) i 5 TGATTTGTCTGTAATTGCCAGC3 (odwrotny starter).
Linia komórkowa kostniakomięsaka, która powstała z guza biorcy miała czas podwojenia 168 godzin (7 dni) (normalny czas podwojenia w wygenerowanej linii komórek kostniakomięsaka wynosi 1,4 do 37,0 dni). Komórki wyrażały mezenchymalne markery komórek macierzystych (CD44, CD29, CD105, CD90 i CD73) na bardzo wysokim poziomie (Figura 1), ale nie wykazywały ekspresji CD45, CD14, CD34, CD49 lub CD24. Komórki z linii komórkowej kostniakomięsaka badano za pomocą analizy cytogenetycznej i fluorescencyjnej hybrydyzacji in situ (FISH) z użyciem specyficznej sondy dla genu p53.3 Pięćdziesiąt metafaz analizowano po bandowaniu GTG Znaleziono dwa różne kariotypy: 47XY, -5, + 22, + m i 45XY, -12, -15, + m. Próbki krwi od biorcy i dawcy miały kopie chromosomu 17 typu dzikiego, podczas gdy linia komórek osteosarcoma wykazała trisomię 17 w 22 z 100 jąder interfazowych. Ani analiza cytogenetyczna, ani analiza FISH p53 pierwotnego guza nie została wykonana z powodu nieodpowiedniej próbki iz powodów etycznych, mezenchymalne komórki macierzyste dawcy nie były analizowane w momencie rozpoznania osteosarcoma. Półilościowa metoda polegająca na amplifikacji polimorficznych genów reakcji łańcuchowej wykazała całkowite chimeryzowanie dawcy komórek krwiotwórczych biorcy, komórek z próbki z biopsji osteosarcoma i linii komórek osteosarcoma (Figura 1) .3 Ponadto próbki krwi z dawcy i biorcy, próbkę z biopsją osteosarcoma i linię komórkową kostniakomięsaka mieli mutację L15R egzonu 2 genu NDP, podczas gdy komórki wymazu z jamy ustnej biorcy nie.
Nasze dane sugerują, że pochodził od dawcy kostniakomięsak. Zmutowany NDP w komórkach kostniakomięsaka najprawdopodobniej był markerem chimeryzmu, ponieważ rak nie rozwijał się u dawcy, a choroba Norriego nie jest związana ze zwiększonym ryzykiem raka.
Massimo Berger, MD
Michela Muraro, MD
Franca Fagioli, MD
Ospedale Infantile Regina Margherita, 10126 Turyn, Włochy
massimo. to
Stefano Ferrari, MD
Istituto Ortopedico Rizzoli, 40136 Bolonia, Włochy
3 Referencje1. Bielack SS, Rerin JS, Dickerhoff R, i in. Osteosarcoma po alogenicznym transplantacji szpiku kostnego: raport z czterech przypadków ze współpracy Osteosarcoma Study Group (COSS). Przeszczep szpiku kostnego 2003; 31: 353-359
Crossref Web of Science Medline
2. Rosenberg T. Epidemiologia dziedzicznych zaburzeń oka. Dev Ophthalmol 2003; 37: 16-33
Crossref Medline
3. Gokgoz N, Wunder JS, Musy S, Eskandarian S, Bell RS, Andrulis IL. Porównanie mutacji p53 u pacjentów z zlokalizowanym kostniakomięsakiem i przerzutowym kostniakomięsakiem. Cancer 2001; 92: 2181-2189
Crossref Web of Science Medline
(14)
[podobne: cennik implantów, dentystyka, hologramy na legitymację studencką ]

Powiązane tematy z artykułem: cennik implantów dentystyka hologramy na legitymację studencką